Antibiofilm activity of carvacrol loaded chitosan nanoparticles against Listeria monocytogenes

Aims@#This study was designed to evaluate the effectiveness of the synthesised carvacrol loaded chitosan nanoparticles (CLCNPs) on the growing and pre-formed biofilms of Listeria monocytogenes isolated from slaughterhouses.@*Methodology and results@#The swab samples were collected from knives, hocks and cutting tables representing slaughterhouses meat contact surfaces (MCS), while those samples from walls and floors represent slaughterhouses meat non-contact surfaces (MNCS). The bacteriological analysis revealed the existence of L. monocytogenes with a prevalence rate of 3.3, 10 and 6.7% for knives, hocks and cutting tables, respectively and 2.2 and 6.6% for walls and floors, respectively. The isolates L. monocytogenes were assayed for biofilm production by the crystal violet binding assay method. Among the 10 L. monocytogenes isolates, 10%, 50% and 30% of the isolates were found to be strong, moderate and weak biofilm producers, respectively. The activities of carvacrol, chitosan nanoparticles (NPs) and CLCNPs against the only strong biofilm producer strain of L. monocytogenes were tested by microtiter plate assay. The minimum inhibitory concentrations (MIC) values were 3.75 mg/mL for CAR, 5 mg/mL for chitosan NPs and 0.62 mg/mL for CLCNPs. CLCNPs inhibit the produced biofilm by 35.79, 73.37 and 77.76%, when 0.5 MIC, 1 MIC and 2 MIC were used, respectively. Furthermore, the pre-formed L. monocytogenes biofilms were significantly reduced from 1.01 (control) OD570 to 0.40 and 0.29 OD570 by applying 2 MIC and 4 MIC doses, respectively.@*Conclusion, significance and impact of study@#The data generated is promising to develop bio-green disinfectants to inhibit biofilm formation by L. monocytogenes in the food processing environment and control its adverse effects for consumers.

Molecular characterization of drug resistant Listeria monocytogenes from food and water samples

Aims@#Present research is focused on the molecular level characterization of drug-resistant Listeria monocytogenes identified from food and water samples from Tamil Nadu, India. @*Methodology and results@#A total of 39 food and water samples were collected from local markets and retail shops in Tamil Nadu, India and processed for the isolation and identification of bacteria. Morphology of the bacteria was analysed under a fluorescent microscope. Isolated bacteria were serotyped and screened for the presence of virulence-associated genes haemolysin (hlyA) and invasive associated protein (iapA) by Real-time polymerase chain reaction. The qPCR positive isolates were also typed by random amplified polymorphic DNA-PCR for epidemiological study. Antibiotic resistance test was done with 16 commercial antibiotics by disc diffusion method. A total of 8 (20.51%) L. monocytogenes were identified belonging to the serotype group 1/2a, 1/2b, 1/2c and 4b. PCR assays revealed the presence of hlyA (456 bp) and iapA (131 bp) genes. In RAPD, OPA-10 primer was found to generate the distinct polymorphic fragment among the isolates. All the isolates were 100% resistant to rifampicin, co-methoxazole, linezolid and oxacillin and 100% sensitive to tetracycline and chloramphenicol. Tetracycline and chloramphenicol are suggested to be a very effective antibiotic against the tested L. monocytogenes isolates. @*Conclusion, significance and impact of study@#The hlyA and iapA based quantitative PCR technique could be a rapid molecular technique for the detection of L. monocytogenes used in this study. Serotyping along with RAPD-PCR was able to discriminate between the isolates and therefore could serve as a robust and sensitive tool for typing antibiotic-resistant strains of L. monocytogenes.

Effectivity of Lactobacillus plantarumBSL against Listeria monocytogenesin rats 282-292

@#Aims:To evaluate the effectivity of Lactobacillus plantarumBSL isolated from Indonesian sauerkraut against Listeriamonocytogenes ATCC 7644through in vitroand in vivoassay. Methodology and results:In vitroexamination for antimicrobialactivity against L.monocytogenesATCC 7644was performed using seven isolates of lactic acid bacteria (LAB). LactobacillusplantarumBSL demonstrated the highest activity against L. monocytogenesandstudied further in Sprague-Dawley (SD) rats. Treatmentgroup of rats received 0.5 mL culture suspension (109CFU/mL) of L. plantarumBSL and control group received 0.5 mL of 0.85% w/v NaCl daily during nine days of treatment. Both groups were infected at 3rd day with0.5 mL of suspension of L. monocytogenes (109CFU/mL). At the 2nd(before infection), 5th, 7th, and 9thday (after infection), the rats were sacrificed and the faeces, caecum, and caecum content were examined for the population of LAB and L. monocytogenes. Administration of L. plantarumBSL significantly increased the population of LABby 1.2–1.4 log unit, while the number of L. monocytogeneswas reduced by 1.8–1.9 log unitcompared to control group eithr in the faeces, caecum, or caecum content. Administration of L. plantarumBSLcould be able to reduce the liver and spleen damageof the experimental rats, butdid not show any changes in immunoglobulin A (IgA) response in comparison with control group. Conclusion, significance and impactofstudy: LactobacillusplantarumBSL was promising as probiotic candidate with health promotion to protect the gastrointestinal from infection by L. monocytogenesATCC 7644.

Effect of peracetic acid on biofilms formed by Listeria monocytogenes strains isolated from a Brazilian cheese processing plant

ABSTRACT This study aimed to investigate the effect of peracetic acid (PAA, 0.5%) on adherent cells of three strains of Listeria monocytogenes strains belonging to serotypes 4b and 1/2b that had been previously isolated from the environment of a Brazilian cheese plant. The assays were conducted using polystyrene microplates and stainless steel coupons and the adhered cells were treated with PAA for 60, 120 and 180 s. On stainless steel, biofilms were partially inactivated by PAA after 60 s and almost 100% of the cells were damaged within 180 s using epifluorescence microscopy with LIVE/DEAD® staining. On polystyrene microplates, PAA decreased (P<0.05) biofilm biomass produced by the three L. monocytogenes isolates at 60 s, when compared with controls (no PAA treatment). However, PAA did not completely eliminate L. monocytogenes cells on polystyrene microplates (decreasing 1.8-2.5 log cycles after treatment with PAA for 180 s). The correct concentration and contact time of PAA is critical for eliminating biofilms formed by L. monocytogenes on stainless steel surfaces, although further studies are needed for defining efficient PAA treatments to remove adherent cells of this pathogen on plastic polymers

Antimicrobial effect of ethanol extract of leaf neem (Azadirachta indica A. Juss) on Listeria monocytogenes

Listeria monocytogenes es un patógeno causante de enfermedades alimentarias. En la búsqueda de controlar su propagación utilizando sustancias naturales se planteó el objetivo de mostrar si el extracto etanólico foliar de neem (Azadirachta Indica A. Juss.) tiene efecto antimicrobiano sobre L. monocytogenes ICTA-12446. El extracto se obtuvo a partir de hojas de neem sometidas a secado por 8 días, se redujeron de tamaño mecánicamente, se sometieron a maceración en frío por 3 días usando etanol 96% en recipientes ámbar, se filtró y concentró en rota evaporador. Se estandarizó el concentrado con dimetilsulfóxido (DMSO) a una concentración de 60 mg/L. Listeria monocytogenes ICTA-12446, fue inoculado en caldo nutriente junto con soluciones del extracto a diferentes concentraciones (20, 30, 40, 50 y 60 mg/L), se emplearon tiempos de contacto (2.5, 5, 10 y 15 minutos). Cumplido cada tiempo se realizaron diluciones seriadas e inocularon en agar nutritivo por extensión durante 24 h a 37ºC. Se efectuó el recuento en Unidades Formadoras de Colonias UFC. Al comparar las concentraciones del extracto se evidencia entre 20 y 60 mg/mL diferencia significativa, mientras que en 30, 40 y 50 mg/mL un comportamiento similar. Al contrastar tiempos de contacto, se observa que entre el tiempo 2.5 min y los restantes un p=0,03. El tiempo mínimo donde existió inhibición fue 2.5 minutos, y concentración mínima inhibitoria de 20 mg/mL. Los cuatro tiempos de contacto arrojan porcentajes de inhibición microbiana de 100% al emplear 60mg/mL. Se concluye que el extracto etanólico foliar de neem posee un efecto inhibitorio sobre Listeria monocytogenes(AU)

Listeria monocytogenes is a pathogen causing foodborne illness. In seeking to control its spread using natural substances in order to show if the leaf ethanol extract of neem (Azadirachta indica A. Juss) has antimicrobial effect on L. monocytogenes ICTA-12446, was proposed. The extract was obtained from neem leaves, which was subjected to drying for 8 days. It was reduced in size mechanically, and subjected to cold soak for 3 days, using 96% ethanol in amber vessels, filtered and concentrated in rot evaporator. Concentrated was solubilized with dimethylsulfoxide (DMSO) and standarized to achieve a concentration of 60 mg/mL Listeria monocytogenes was inoculated in nutrient broth with extract solutions at different concentrations (20, 30, 40, 50 and 60mg/mL), four contact times (2.5, 5, 10 and 15 minutes) were used. Completed each time it was diluted and inoculated on nutrient agar by extension for 24h at 37ºC. The count of Colony Forming Units UFC was taking. Comparing the concentrations of the extract between 20 and 60mg /mL significant difference was appreciate, while 30, 40 and 50 mg/mL show a similar behavior. Contrasting contact times observed between time 2.5 min and the remaining p = 0.03. The minimum time where there was some kind of inhibition was 2.5 minutes, and minima inhibitory concentration of 20mg/mL. The four contact times yield microbial inhibition percentages of 100% by using 60mg/L. It is concluded that ethanol extract of neem leaf has an inhibitory effect on L. monocytogenes(AU)

Different methods to quantify Listeria monocytogenes biofilms cells showed different profile in their viability

Listeria monocytogenes is a foodborne pathogen able to adhere and to form biofilms in several materials commonly present in food processing plants. The aim of this study was to evaluate the resistance of Listeria monocytogenes attached to abiotic surface, after treatment with sanitizers, by culture method, microscopy and Quantitative Real Time Polymerase Chain Reaction (qPCR). Biofilms of L. monocytogenes were obtained in stainless steel coupons immersed in Brain Heart Infusion Broth, under agitation at 37 °C for 24 h. The methods selected for this study were based on plate count, microscopic count with the aid of viability dyes (CTC-DAPI), and qPCR. Results of culture method showed that peroxyacetic acid was efficient to kill sessile L. monocytogenes populations, while sodium hypochlorite was only partially effective to kill attached L. monocytogenes (p < 0.05). When, viability dyes (CTC/DAPI) combined with fluorescence microscopy and qPCR were used and lower counts were found after treatments (p < 0.05). Selective quantification of viable cells of L. monocytogenes by qPCR using EMA revelead that the pre-treatment with EMA was not appropriate since it also inhibited amplification of DNA from live cells by ca. 2 log. Thus, the use of CTC counts was the best method to count viable cells in biofilms.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Molecular characterization of Listeria monocytogenes isolated from animal products in a city of Northern Brazil / Caracterização molecular de Listeria monocytogenes isolada de produtos de origem animal em uma cidade da região Norte do Brasil

Listeria monocytogenes, a foodborne pathogen causes listeriosis, a fatal disease in about 30% of cases that affects mainly immunocompromised persons. The aim of this research was to characterize L. monocytogenes pulsed-field gel electrophoresis (PFGE) types isolated from meat products collected at public markets in Araguaina city, TO. Sixty samples of raw ground beef and frescal sausage were analyzed during the second half of 2008. Five out of 30 samples (16.7%) of raw ground beef tested positive for L. monocytogenes, three of which were classified as serotype 1/2b and two as serotype 4b. Among the 30 samples of sausage collected, two strains of L. monocytogenes were isolated (6.7%), one of them belonging to serotype 1/2a and the other belonging to serotype 1/2b. The restriction enzymes used were ApaI and SmaI. Similarities among the strains were determined by Dice coefficient. The macro restriction profile obtained by using SmaI enzyme allowed the distribution of seven strains in two clusters, two pulsotypes and two subtypes. The result indicates that L. monocytogenes isolates, belonging to serotype 4b, 1/2a and 1/2b, are strongly correlated within the same serotype group, and in some cases among different serotypes, suggesting that they have a common source.

Listeria monocytogenes é um patógeno de origem alimentar que causa a listeriose, doença fatal em aproximadamente 30% dos casos, e que afeta principalmente pessoas imunocomprometidas. O presente trabalho teve como objetivo analisar os perfis PFGE de cepas de L. monocytogenes isoladas de produtos de origem animal, obtidos em mercados públicos da cidade de Araguaína, TO. Foram analisadas 60 amostras de carne moída crua e de linguiça frescal, no segundo semestre de 2008. Cinco (16,7%) das 30 amostras de carne moída crua foram positivas ao patógeno, sendo que três pertenciam ao sorotipo 1/2b e duas ao sorotipo 4b. Das 30 amostras de linguiça mista frescal, duas (6,7%) foram positivas para L. monocytogenes, sendo uma do sorotipo 1/2a e outra do 1/2b. Foram utilizadas as enzimas de restrição ApaI e SmaI. A similaridade entre eles foi determinada pelo coeficiente de Dice. A análise do perfil de macrorestrição com a enzima SmaI permitiu a distribuição dos sete isolados em dois clusters, dois pulsotipos e dois subtipos. Os resultados permitiram concluir que os isolados de L. monocytogenes sorotipos 4b, 1/2a e 1/2b foram fortemente correlacionados dentro dos mesmos sorotipos e em alguns casos entre diferentes sorotipos, sugerindo uma fonte comum.

Prevalencia de Listeria monocytogenes en carnes y derivados de la industria porcícola colombiana / Prevalence of Listeria monocytogenes in pork-meat and other processed products from the Colombian swine industry

Objective. To determine the prevalence of L. monocytogenes in pork carcasses, meat cuts, and meat products (“chorizo”, sausage and ham). Materials and methods. Stratified sampling was implemented in meat-processed products. We analyzed 566 (37%) carcasses, 472 (31%) meat cuts, and 481, (32%) meat-processed products, distributed as follows: 169 (11%) sausage, 163 (11%) ham, and 149 (10%) “chorizo”, for a total of 1519 (100%) samples in a period of 18 months. The samples were processed using the ISO-17604, ISO-11290-1 and the USDA/FSIS (MLG-8.03) methods. Genus and species were confirmed by multiplex-PCR. Results. We obtained isolates of L. monocytogenes from 21 carcasses (10%), 160 (76%) from meat deboning, 10 (5%) from ham, 6 (3%) from “chorizo”, and 13 (6%) from sausage. The prevalence found was 3.7% and 33.9% in carcasses and meat deboning respectively. The prevalence in the meat-processed products was 4.03% in “chorizo”, 6.13% in ham and 7.69% in sausage. The overall prevalence of L. monocytogenes in the study was 13.82%. Conclusions. We found L. monocytogenes in different products analyzed, with particular interest in ham and sausage since both are consumed without previous heat treatment.

Serotipos de Listeria Monocytogenes aislados de alimentos producidos en la provincia de Cautín, Chile / Serotypes of Listeria monocytogenes Isolated on Food Produced in Cautin Province, Chile

En Chile se ha aislado Listeria monocytogenes en diversos alimentos. El objetivo de este estudio fue aportar información sobre la presencia de la bacteria en longanizas artesanales (embutidos madurados), leche cruda y hortalizas producidos en la Provincia de Cautín y determinar los serotipos. Las muestras correspondieron a longaniza común artesanal, leche cruda y hortalizas, colectadas durante 2003. Para el aislamiento e identificación de L. monocytogenes se usó la metodología aprobada por el Food and Drug Administration (FDA) con incubación en caldo selectivo preenrriquecimiento para Listeria (35°C), y posterior siembra en medios selectivos Oxford y Palcam (35-37°C). Las colonias típicas fueron replicadas en caldo tripticasa de soya (TSB) y sometidas a pruebas bioquímicas de identificación. La serotipificación se realizó sobre 53 cepas, utilizando un set de antisuero comercial. L. monocytogenes se presentó en el 61,1% de las longanizas, en el 0,0% de las muestras de leche cruda y en el 16,6% de las de hortalizas. Estos resultados podrían indicar fallas en la higiene de la manipulación, en el lavado y sanitización de superficies de contacto con los alimentos. Se determinó la presencia del serotipo 4e en 3 cepas provenientes de longanizas fabricadas en la ciudad de Temuco, y 1 cepa de cada uno de los serotipos virulentos 1/2a, 1/2b y 4b, los dos primeros provenientes de longanizas y el último desde hortalizas. La presencia de estos serotipos 1/2a, 1/2b y 4b, plantean una clara amenaza de un eventual brote, particularmente en consumidores susceptibles. Estos resultados representan un importante desafío de prevención y control para las autoridades sanitarias chilenas.

It has been reported in Chile that L. monocytogenes is present in differents kind of foods. The aim of this study was to obtain information of the occurrence of the bacteria in sausages, raw milk and vegetables produced in Cautín Province, and to know the L. monocytogenes serotypes involved. For this purpose sausages, raw milk and several vegetables samples, were collected on 2003. For the isolation and identification of L. monocytogenes, the samples were grown in tripticase soy broth (TSB) inoculated into a preenrichment broth for Listeria (35°C followed by an inoculation on selectives medias Oxford and Palcam (35-37°C). Biochemical test were performed to all the typical Listeria colonies according to the methodology recommended by Bacteriological Analytical Manual (FDA). Serotyping was carried out using commercial specific antisera on 53 bacterial strains. Results of the analysis indicated the presence of L. monocytogenes in 61.1% of sausages samples, 0.0% in raw milk samples and in 16.6% of vegetables samples. These results could indicate failure in the hygiene practices, like cleaning and sanitizing the surface in contact with the food. The presence of serotipe 4e in 3 strains were found in some sausages. There was a strain of virulent serotype 1/2a, 1/2b and 4b, the first and second resulted isolated from sausages and the third one resulted from vegetables. The presence of serotypes 1/2a, 1/2b and 4b, is a threat of an eventual out-break, especially in persons quite susceptive, that is why, there is a huge risk for pubic health in customers from this region. These results represent for chilean public´s health authorities an enormous challenge for controlling and prevention procedures.

Caracterizaciónppreliminar de compuestos antiliteriales producidos por bacteriias ácido lácticas nativas / Partialcharacterrization of antilisterial compounds prouced by native lactic acid bacteria

Objetivo. Caracterizar los metabolitos producidos por bacterias ácido lácticas nativas con capacidad antilisterial. Materiales y métodos. Se analizaron 42 muestras tomadas de alimentos y equipos procesadores de alimentos, de donde se aislaron bacterias ácido lácticas, las cuales se identificaron por medio de pruebas bioquímicas. Se evaluó la actividad antagónica de las cepas aisladas frente a 17 cepas de L. monocytogenes pertenecientes a los serotipos 4b, 4e, y 3b utilizando la técnica de la gota y doble capa. Se obtuvieron extractos crudos para la caracterización de los metabolitos inhibitorios del crecimiento de las cepas de L. monocytogenes, los cuales fueron tratados con catalasa, ácido clorhídrico, proteinasa K y temperaturas de 95°C y 121°C. El peso molecular de las proteínas se aproximó utilizando la técnica de electroforesis SDS-PAGE y bioensayos. Resultados. De un total de 250 aislamientos se lograron identificar 75 cepas de bacterias ácido lácticas. La evaluación de la actividad antagónica indicó que los metabolitos inhibitorios producidos por las bacterias ácido lácticas no actuaban de igual manera frente a las diferentes cepas de L. monocytogenes. Sin embargo, se encontró que tres de los aislamientos nativos identificados como Lactobacillus spp., Leuconostoc spp. y Enterococcus spp. presentaban una mejor actividad antilisterial debido a que sintetizan proteínas o metabolitos de peso molecular menor a 7600 Da. Conclusiones. En los alimentos distribuidos en Colombia existen cepas de bacterias ácido lácticas con potencial bioprotector.

Objective. Characterization of antilisterial compounds produced by native lactic acid bacteria. Materials and methods. Lactic acid bacteria (LAB) were isolated from 42 samples collected from foods and food processing equipment. Identification of LAB species was assessed by biochemical reactions. The antilisterial activities of the isolates were tested against 17 L. monocytogenes strains belonging to 4b, 4e and 3b serotypes, by the agar differed spot on the lawn technique. Crude extracts were subjected to catalase, proteinase K, hydrochloric acid and high temperature (95°C and 121°C) treatments in order to characterize the antilisterial compounds. The molecular weights were estimated by SDS-PAGE and bioassays were performed. Results. Seventy five strains were identified out of 250 lactic acid bacteria isolates. The inhibitory compounds produced by LAB displayed dissimilar activities against the different L. monocytogenes strains. Furthermore, three native isolates identified as Lactobacillus spp., Leuconostoc spp. and Enterococcus spp. showed improved antilisterial effect due to the production of compounds with molecular weight below 7600 Da. Conclusions. We demonstrated the presence of native lactic acid bacteria with potential as biocontrolers in foods distributed in Colombia.

Determinación Microbiológica y Molecular de Listeria sp. y Listeria monocytogenes en Cerdas a nivel de una planta beneficiadora en EUA

Con el objeto de comparar la técnica de PCR múltiple con el método microbiológico comercial para la determinación de la presencia de Listeria spp. y Listeria monocytogenes en alimentos, se llevó a cabo un muestreo en una planta procesadora de cerdas de descarte ubicada en Estados Unidos de Norteamérica (EUA). A 160 cerdas sacrificadas, se le tomaron muestras de ganglios sub-ilíacos, ganglios ileocecales, contenido cecal e hisopado de la superficie de las canales. Adicionalmente se tomaron muestras del ambiente de la planta y de cortes de carne. Un total de 708 muestras se procesaron con ambas técnicas. Mediante técnicas microbiológicas, el 5,2% resultaron positivas a Listeria spp. y el 0,14% a L. monocytogenes. Mediante la técnica de PCR 4,1% resultaron positivas a Listeria spp. y 0,85% positivas a L. monocytogenes. No se observó diferencias significativas (P > o = 0,05) entre estos valores. Se determinó una incidencia del 1,9% de Listeria spp. en los hisopados de la superficie de las canales de las cerdas evaluadas. Por otro lado, se identificó L. monocytogenes, en el 5% de las muestras de cortes de carne. En relación a los ganglios, los sub-ilíacos presentaron 6,3% de incidencia a Listeria spp. y de 1,3% a L. monocytogenes no encontrándose en ganglios ileocecales. Para el contenido cecal la incidencia a Listeria spp. fue de 19% y para L. monocytogenes fue de 2,5%. En el ambiente el 4,2% de las muestras resultaron positivas a Listeria spp. y ninguna a L. monocytogenes. Al comparar los resultados logrados entre ambas técnicas no hubo diferencia significativa entre los valores obtenidos con las muestras de los hisopados de las canales y la de los ganglios ileocecales. Si hubo diferencia significativa entre los resultados de contenido cecal P = 0,0168 < 0,05 y de los ganglios sub-ilíacos P = 0,0038 < 0,05. La utilización de la técnica de PCR múltiple, permitió que los resultados se obtuvieran en 8 h, luego del segundo período de enriquecimiento de cada muestra, y con el método microbiológico convencional el procedimiento tomó 8 días. La incorporación de la metodología molecular en el proceso de verificación del status microbiológico en la industria de alimentos, resulta una mejora para la efectividad y la dinámica en los sistemas de seguridad alimentaria.

Listeria spp. and Listeria monocytogenes presence in a cull sows processor plant in USA, was evaluated by and PCR multiplex method. 160 cull sows were surveyed after slaughter. Samples were collected from sub-iliac node, iliocecal node, cecal content and carcass swabs. Additionally samples were taken from environment plant and from raw meat ready to be processed. A total of 708 samples were processed. Using traditional microbiology method were found 5.2% of samples positive to Listeria spp. and 0.14% to L. monocytogenes. With PCR multiplex 4.1% were positive to Listeria spp. and 0.85% to L. monocytogenes. There was not significant difference (P > or = 0.05) in the results obtained with PCR multiplex and traditional microbiology procedures. In relation with the raw material that leaves the slaughter area to be processed inside the same plant, Listeria spp. was observed in 1.9% swabs carcass, and 5% of raw sow meat sampled. Listeria spp. was identified in 6.3% and L. monocytogenes in 1.3% of subiliac nodes. It was not any iliocecal node positive to Listeria. Samples supposedly related with the infection source in the process plant, cecal content sample were 19% positive to Listeria spp. and 2.5% to L. monocytogenes. Environmental samples were 4.2% positive to Listeria spp. There were not differences between the conventional microbiology procedure and PCR multiplex technique for this pathogen when carcass swabs and ilicecal node were evaluated with both techniques. Differences were observed between the samples from cecal content and sub-iliac node P = 0.0168 < 0.05 and P = 0.0038 < 0.05 respectively. With the PCR multiplex technique, results were obtained in 8 hours after the second enrichment culture period of the each sample. With traditional microbiological it took 8 days. The incorporation of molecular methodology in the verification process for microbiological controls in the food industry, would allow an important improvement of the effectiveness and dynamics in the food safety systems implanted at the food industries.

Prevalencia de Listeria monocytogenes en derivados cárnicos analizados en el Laboratorio de Salud Pública de Bogotá. 1 septiembre 2001- 31 agosto 2004 / Prevalence of Listeria monocytogenes in meat derivatives analyzed at the Public Health Laboratory of Bogotá. September 1, 2001- August 31, 2004

Antecedentes. La Listeria monocytogenes es un bacilo Gram positivo, aerobio o anaerobio facultativo ubicuo; aislado en el hombre y en mamíferos domésticos, salvajes, pájaros, peces y crustáceos. Causa la listeriosis, provocando abortos, septicemias y meningitis. Es una enfermedad transmitida por alimentos. En los Estados Unidos, cada año un promedio 1.100 personas sufre esta enfermedad. Objetivo. Determinar la prevalencia de L. monocytogenes en derivados cárnicos cocidos, en muestras analizadas en el Laboratorio de Salud Pública (LSP) de Bogotá, entre el 1 de septiembre de 2001 y el 31 de agosto de 2004. Método. Estudio descriptivo de los productos cárnicos procesados que se producen en el Distrito Capital, muestreados por las Empresas Sociales del Estado; es una muestra no probabilística ni representativa. El estudio analizó los resultados microbiológicos en los derivados cárnicos durante tres años.Resultados. De una muestra total de 1.071 derivados cárnicos, 120 fueron positivos para L. monocytogenes (11,2%). La prevalencia en cada año fue 11,70%, 10,1% y 11,5%, respectivamente. De los serotipos identificados, 45% corresponde al serotipo 4b, seguido por el ½b (10,0%) y el 3b (9,2%). Conclusiones. El jamón, fue el producto con mayor positividad para la Listeria monocytogenes (55,8%), superior a las salchichas (17,5%) y la mortadela (12,5%). Se evidencia la importancia en Salud Pública de la Listeria monocytogenes por su elevada prevalencia. Otros microorganismos detectados en las muestras indican que los alimentos tienen fallas de manipulación, mala calidad de materias primas y contaminación cruzada con Salmonella s.ps, Estafilococo coagulasa positivo y L. monocytogenes, en alimentos listos para el consumo.

Background. Listeria monocytogenes is a Gram-positive bacillus, ubiquitous aerobic or facultative anaerobic facultative; isolated in man and in domestic and wild mammals, birds, fish and crustaceans. It causes listeriosis, causing abortions, septicemia and meningitis. It is a foodborne disease. In the United States, an average of 1,100 people suffer from this disease each year. Objective. To determine the prevalence of L. monocytogenes in cooked meat derivatives, in samples analyzed at the Public Health Laboratory (LSP) of Bogotá, between September 1, 2001 and August 31, 2004. Method. Descriptive study of processed meat products produced in the Capital District, sampled by the State Social Enterprises; it is a non-probabilistic and non-representative sample. The study analyzed the microbiological results in meat derivatives during three years.Results. From a total sample of 1,071 meat derivatives, 120 were positive for L. monocytogenes (11.2%). The prevalence in each year was 11.70%, 10.1% and 11.5%, respectively. Of the serotypes identified, 45% corresponded to serotype 4b, followed by ½b (10.0%) and 3b (9.2%). Conclusions. Ham was the product with the highest positivity for Listeria monocytogenes (55.8%), higher than sausages (17.5%) and mortadella (12.5%). The importance of Listeria monocytogenes in public health is evidenced by its high prevalence. Other microorganisms detected in the samples indicate that the food has handling failures, poor quality of raw materials and cross contamination with Salmonella s.ps, coagulase positive Staphylococcus and L. monocytogenes, in ready-to-eat foods.

Prevalência de listeria spp em amostras de carne de frango obtidas em abatedouros do Estado de São Paulo / Prevalence of listeria spp in samples of chicken meat obtained in s slaughtherhouses of the State of São Paulo

Listeria monocytogenes está envolvida em surtos humanos relacionados a alimentos, embora, no Brasil a doença em humanos seja pouco relatada. Enfoque renovado foi dado a esta bactéria após surtos de doenças de origem alimentar (DOA) ocorridos na América do Norte e Europa durante os anos de 1980 e 1990. Listeria spp é freqüentemente isolada de carnes cruas, incluindo as de frango, como resultado de ampla contaminação cruzada em plantas industriais. A carne de frango é parte integrante da dieta dos brasileiros como fonte de proteína animal, assim, é importante que se conheça a prevalência deste agente neste tipo de alimento. Para tanto, foram examinadas 74 (setenta e quatro) amostras de carne de frango (coxa, sobrecoxa, peito, frango à passarinho e inteiro) utilizando-se métodos de isolamento de Listeria spp com meios de enriquecimento e seletivos, e reação em cadeia de polimerase (PCR), para confirmação dos testes bioquímicos. Em apenas uma das amostras foi detectada a presença de L. monocytogenes. Aventa-se, para o baixo índice de listérias encontrado, a ação antimicrobiana determinada pelo uso de descontaminantes nos tanques de resfriamento dos abatedouros.

Listeria monocytogenes is responsible for food borne disease, although in Brazil there is little data about this agent. Renewed emphasis has been given to this bacterium after the North American and European outbreaks during the 1980s and 1990s. Listeria spp is usually isolated from raw meat, including chicken, due to cross contamination in industrial plants. Chicken meat plays an important role in the diet of Brazilian people as an animal protein source. This work was aimed at investigating this bacterium' s prevalence in different cuts of chicken sampled at slaughterhouses. To achieve this, 74 chicken samples (drumsticks, thighs, breasts, entire chickens cut-up and whole) were cultivated in Listeria spp enrichment and selective culture media, and submitted to polymerase chain reaction to confirm the biochemical tests. Just one sample was positive for L. monocytogenes. As one possible explanation for the low level of listeria found, the authors point to the antiimicrobial action of disinfectant products used in the chilled tanks of slaughther houses.